Skip to main content

Advertisement

Table 1 Size of DNA fragments obtained by PCR with the novel oligonucleotides tested in this study.

From: Design of an improved set of oligonucleotide primers for genotyping MeCP2tm1.1BirdKO mice by PCR

  P3 RV GF RV
  CCACCCTCCAGTTTGGTTTA GTTTTGTTCCCCACCCTCCA
GF KO FW 475 486
ACTTTGTCCTGCTGCCTCCA   
P3 KO FW 458 469
CCATGCGATAAGCTTGATGA   
P3 WT FW 411 421
GACCCCTTGGGACTGAAGTT   
GF WT FW 413 424
TCGGACCCCTTGGGACTGA   
  1. These oligonucleotides were chosen by submitting sequences AM691835 and AM691836 to the P3 [8] and gene Fisher [9] primer-design web servers.