Skip to main content

Table 1 Primer and probe lists.

From: Optimisation of region-specific reference gene selection and relative gene expression analysis methods for pre-clinical trials of Huntington's disease

GENE FORWARD PRIMER REVERSE PRIMER PROBE (5' FAM, 3' TAMRA)
Arl6ip2 TTTGGAATGAAGTGTTTGTGATTGA GGCACCCTGGGTATCCATTA AGACCTAATGGAACAAAAGTGGCTGTGCTG
Actb GCTTCTTTGCAGCTCCTTCGT CCAGCGCAGCGATATCG CGGTCCACACCCGCCACCAG
Bdnf I GCAAAGCCGAACTTCTCACAT GCAACCGAAGTATGAAATAACCATAG TTCCACCAGGTGAGAAGAGTGATGACCAT
Bdnf IIa ACAGAGCCAGCGGATTTGTC GCAACCGAAGTATGAAATAACCATAG TTCCACCAGGTGAGAAGAGTGATGACCAT
Bdnf IIb AGTTGGCTTCCTAGCGGTGTAG GCAACCGAAGTATGAAATAACCATAG TTCCACCAGGTGAGAAGAGTGATGACCAT
Bdnf IIc TGCAACTCTTTATCACCAGGATCTA GCAACCGAAGTATGAAATAACCATAG TTCCACCAGGTGAGAAGAGTGATGACCAT
Bdnf III GGGCCGGATGCTTCCTT GCAACCGAAGTATGAAATAACCATAG TTCCACCAGGTGAGAAGAGTGATGACCAT
Bdnf IV CTGCCTTGATGTTTACTTTGACAAG GCAACCGAAGTATGAAATAACCATAG TTCCACCAGGTGAGAAGAGTGATGACCAT
Bdnf V GGGATCCGAGAGCTTTGTG GCAACCGAAGTATGAAATAACCATAG TTCCACCAGGTGAGAAGAGTGATGACCAT
Bdnf VI TCCTGAGGAAGTGAAAGTTTTGACT GCAACCGAAGTATGAAATAACCATAG TTCCACCAGGTGAGAAGAGTGATGACCAT
Bdnf VII GATTGCTGAAAATGGTGTCGTAAA GCAACCGAAGTATGAAATAACCATAG TTCCACCAGGTGAGAAGAGTGATGACCAT
Bdnf VIII CTGGATGCCGCAAACATGTC CTGCCGCTGTGACCCACTC TCACACACGCTCAGCTCCCCACGG
Cnr1 CACAAGCACGCCAATAACACA ACAGTGCTCTTGATGCAGCTTTC CCAGCATGCACAGGGCCGC
Darpp32 CCCGACAGGTGGAGATGATC GCTGCACAGCTTTCAGTGATG CTGCCATGCTTTTCCGGGTCTCAGA
Drd2 ACACCACTCAAGGGCAACTGT GGCGGGCAGCATCCA CCCTGAGGACATGAAACTCTGCACCG
Grin1 TCAGTGTGTGAGGACCTCATCTCT GAGTGAAGTGGTCGTTGGGAGTA CAGGTCTACGCTATCCTAGTTAGTCACCCGCC
Hdh CTCAGAAGTGCAGGCCTTACCT GATTCCTCCGGTCTTTTGCTT TGAATCTTCTTCCATGCCTGACCCGA
HD (transgenic) GCTGCACCGACCGTGAGT CGCAGGCTGCAGGGTTAC CAGCTCCCTGTCCCGGCGG
Igfbp5 AAGGATTCTACAAGAGAAAGCAGTGTAA ACTTGTCCACACACCAGCAGAT TCCCGTGGCCGCAAACGTG
Kcnk2 GACTACGTGGCAGGTGGATCA GCCAGCCCAACGAGGAT AATATCTGGACTTCTACAAGCCTGTGGTGTGGT
Nab2 GGGAGGGCAAACAGCTTAGC AGTGTTGTCCCTCATGCAGAACT ACCATCAACGAGGCTGCTGCC
Nr4a2 ATTTCCTCGAAAACTCCAATAACTCT TGAGGCGAGGACCCATACTG CTGAAGCCATGCCTTGTGTTCAGGC
Pcp4 CTGAGCTGTTCTGTGGGACCTA CGCTCCGGCACTTTGTCT CTGCGGAGTCAGGCCAACATGA
Penk1 ATGCAGCTACCGCCTGGTT GCAGCTGTCCTTCACATTCCA AGGCGACATCAATTTCCTGGCGTG
Polr2a GGTGCTGAGTGAGAAGGATGTAGA ATGCCCAGTACCGTGAAGATCT TGCGCACCACGTCCAATGATATTGTG
Psme1 TGATGACCAACCTTCACACCAA TCACCCCTCTCGGAGAAGTACT' CTGGAAGGCTTCCACACGCAGATCTCC
Sez6 TGTGCCAGTGGGACCTAAGC TCACAGACATATTGCACAGTTGCT CATGCCAGAGAGTGACATCTTGCCA
Tbr2 CAAAGGCTTCCGGGACAAC GGGAGATGGAGTTAACCTGTCATTT CGATTCCATGTACACGGCTTCAG
UchL1 GGTACCATCGGGTTGATCCA AACTGTTTCAGGACGGATCCA AACCAAGACAAGCTGGAATTTGAGGA
Wdr6 GAACAAGCACAAGATGATCAAGGT GCCTATCGTTGTCAAGCTCACA TGAGACCAGGTACATGTCTCTTGCTATT
  1. The forward and reverse primer sequences, together with the Taqman probe sequences for each gene routinely used in our laboratory are listed.
  2. KEY: Arl6ip2 (ADP-ribosylation factor-like 6 interacting protein 2); Actb (beta-actin); Bdnf (Brain-derived neurotrophic factor; Roman numerals refer to promoter-specific amplification); Cnr1 (Cannabinoid receptor 1); Darpp32 (Dopamine and cAMP regulated neuronal phosphoprotein, also known as Ppp1r1b, protein phosphatase 1, regulatory subunit 1B); Drd2 (Dopamine D2 receptor); Grin1 (glutamate receptor, ionotropic, NMDA1 {zeta 1}); Hdh (Murine huntington's disease gene homologue); Htt (Human Huntington's disease gene, used to detect human exon 1 transgene); Igfbp5 (insulin-like growth factor binding protein 5 precursor); Kcnk2 (potassium channel, subfamily K, member 2); Nab2 (Ngfi-A binding protein 2); Nr4a2 (nuclear receptor subfamily 4, group A, member 2); Pcp4 (Purkinje cell protein 4); Penk1 (Preproenkephalin); Polr2a (RNA polymerase II {DNA directed} polypeptide A); Psme1 (proteasome activator 28-α subunit); Sez6 (seizure related gene 6); Tbr2 (eomesodermin homolog), Uchl1 (ubiquitin carboxyl-terminal hydrolase L1), Wdr6 (WD repeat domain 6).