Skip to main content

Table 1 SORL1 PCR primers.

From: Expression of SORL1 and a novel SORL1 splice variant in normal and Alzheimers disease brain

Exons Amplified Primer Primer Sequence
1-5 Exon 1 Forward GAGCTCTCTGCGAAGTCTGG
  Exon 5 Reverse AAAAGGACTTGACATGTTCCTGA
4-8 Exon 4 Forward GCCCAGTACCTCTGGATCAC
  Exon 8 Reverse CTCACCAAGGTGTCACTGC
7-11 Exon 7 Forward CATCTCTTGGGCAGTGAACA
  Exon 11 Reverse CCACCTGGCTCCAGCACT
10-15 Exon 10 Forward CCCATCCTGTCCAAGGAGT
  Exon 15 Reverse AGTAGAACCCACAGGGCAAG
14-18 Exon 14 Forward GAGTGTTTGCTGGGACACAA
  Exon 18 Reverse TTTGAAGCCTGCATCTACCC
17-21 Exon 17 Forward GTGGCCCTGGACTTTGACTA
  Exon 21 Reverse CAGTGTTCTTCCCCTTGTAGAAA
20-24 Exon 20 Forward TTACTGGACGGATGCCTACC
  Exon 24 Reverse TTTCATCACTGTTGTCTCCACA
23-29 Exon 23 Forward TGAGCGATGAGAGAAACTGC
  Exon 29 Reverse TGGAAACCGAACTCATCACA
28-32 Exon 28 Forward CGCACTTCATGGACTTTGTG
  Exon 32 Reverse CCATCCTGGCAATCTTGGT
31-35 Exon 31 Forward TGTCTGCCCAATTACTACCG
  Exon 35 Reverse GTGCCTTGCTGAGACACTGA0
34-40 Exon 34 Forward ATGCCCTCTGCTTCTTGTGT
  Exon 40 Reverse ATGCTTCCTCGGAAGTTCAA
39-43 Exon 39 Forward ATCCCACCACCAGATATCCA
  Exon 43 Reverse CCTGGTCAGGAGAGTCATACG
42-46 Exon 42 Forward ACTCCACAACAAGACGGTCA
  Exon 46 Reverse CAGCTCATCGTACAGCAGGA
45-48 Exon 45 Forward CAGCACCTGATGCCTTAAAAA
  Exon 48 Reverse CATATTGCAACTCAAAGTGCATC
FL-SORL1 Exon 2 Forward GAGGCCCAAGAGCAGTGAT
RT-PCR Primers
Delta-2-SORL1 Exon 1-3 Junction Forward CAAGGTGTACGGACAGGTGTA
Reverse Primer Exon 4 Reverse GCAGAAGTCAAACGTGATCC