Skip to main content

Table 8 Primers used for analyses of BACE2 isoform expression.

From: Rheumatoid arthritis-associated polymorphisms are not protective against Alzheimer's disease

BACE2 Isoform screening primers  
BACE2 Exon 6 Forward: ATAACGCAGACAAGGCCATC
BACE2 Exon 9 Reverse: GGACACAGTTGCTGGCTACA
BACE2 isoform specific RT-PCR primers  
BACE2 Exon 6 Forward: GCCCCAGAAGGTGTTTGAT
BACE2 Exon 6-8 Junction Reverse: GGCTGAATGTAAAGCAGAG
BACE2 Exon 5 Forward: TGGGTGGAATTGAACCAAGT
BACE2 Exon 6 Reverse: GATGGCCTTGTCTGCGTTAT