Skip to main content

Table 1 Primers for real time PCR

From: Autophagy is involved in oligodendroglial precursor-mediated clearance of amyloid peptide

Gene Primer
Mouse-LAMP1-sense CAGCACTCTTTGAGGTGAAAAAC
Mouse-LAMP1-antisense ACGATCTGAGAACCATTCGCA
Mouse-LAMP2-sense ATATGTGCAACAAAGAGCAGGT
Mouse-LAMP2-antisense TGCCAATTAGGTAAGCAATCACT
Mouse-NG2-sense CCCCCCCATACCCATGTC
Mouse-NG2-antisense CGATCGGAAATAACCTGAAGCT
Mouse-Actin-sense CAACGAGCGGTTCCGAT
Mouse-Actin-antisense GCCACAGGATTCCATACCCA