Skip to main content

Table 1 Primers used in the study

From: Protective paraspeckle hyper-assembly downstream of TDP-43 loss of function in amyotrophic lateral sclerosis

Target Forward Reverse
GAPDH 5’-TCGCCAGCCGAGCCA-3′ 5’-GAGTTAAAAGCAGCCCTGGTG − 3′
NEAT1 total 5’-CTCACAGGCAGGGGAAATGT-3′ 5’-AACACCCACACCCCAAACAA-3′
NEAT1_2 5’-AGAGGCTCAGAGAGGACTGTAACCTG-3′ 5′-TGTGTGTGTAAAAGAGAGAAGTTGTGG-3’
TDP-43 5’-TCAGGGCCTTTGCCTTTGTT-3’ 5’-TGCTTAGGTTCGGCATTGGAT-3’
IL8 5’-ACACTGCGCCAACACAGAAA-3′ 5’-CCTCTGCACCCAGTTTTCCT-3’
ADARB2 ATATTCGTGCGGTTAAAAGAAGGTG ATCTCGTAGGGAGAGTGGAGTCTTG
Alu RNA 5’-GAGGCTGAGGCAGGAGAATCG-3’ 5’-GTCGCCCAGGCTGGAGTG-3’
DICER 5’-TTAACCTTTTGGTGTTTGATGAGTGT-3’ 5’-GCGAGGACATGATGGACAATT-3’
DROSHA 5’-CGGCCCGAGAGCCTTTTAT-3’ 5’-TGCACACGTCTAACTCTTCCA-3’
ADAR1 5’-TTGTCAACCACCCCAAGGT-3’ 5’-CCATCAGCCAGACACCAGTT-3’
AGO2 5’-CACCATGTACTCGGGAGCC-3’ 5’-TCCCAAAGTCGGGTCTAGGT-3’
FUS 5’-GCGGGGCTGCTCAGT-3’ 5’-TTGGGTTGCTTGTTGGGTAT-3’
CHOP 5’-TTAAAGATGAGCGGGTGGC-3′ 5’-GCTTTCAGGTGTGGTGATGTA-3’
CXCL10 5’-TGCCATTCTGATTTGCTGCC-3’ 5’-ATGCTGATGCAGGTACAGCG-3’
IFNB1 5’-ACGCCGCATTGACCATCTAT-3’ 5’-AGCCAGGAGGTTCTCAACAA-3’
IFNA1 5’-TCTGCTATGACCATGACACGAT-3’ 5’-CAGCATGGTCCTCTGTAAGGG-3’
IFNA2 5’-AGGAGGAAGGAATAACATCTGGTC-3’ 5’-GCAGGGGTGAGAGTCTTTGAA-3’
MALAT1 5’-GGATCCTAGACCAGCATGCC-3’ 5′- AAAGGTTACCATAAGTAAGTTCCAGAAAA-3’
IFIH1 5’-GCATGGAGGAGGAACTGTTGA-3’ 5’-GCATGGAGGAGGAACTGTTGA-3’
CYCS 5’-TCGTTGTGCCAGCGACTAAA-3’ 5’-GCTTGCCTCCCTTTTCAACG-3’
STAT1 5’-CTGTGCGTAGCTGCTCCTTT-3’ 5’-GGTGAACCTGCTCCAGGAAT-3’
MYD88 5’-TGACCCCCTGGGGCAT-3’ 5’-AGTTGCCGGATCATCTCCTG-3’
Pri-miR-17–92 5’-CAGTAAAGGTAAGGAGAGCTC
AATCTG-3’
5’-CATACAACCACTAAGCTAAAGAAT
AATCTGA-3’
Pri-miR-15a 5’-CCTTGGAGTAAAGTAGCAGCAC-3’ 5’-CCTTGTATTTTTGAGGCAGCAC-3’
miR-18a 5’-CATCATCGGTAAGGTGCATC-3’ 5’-GAATCGAGCACCAGTTACGC-3′ (unimiR)
miR-92a 5’-GAGTCTATTGCACTTGTCCC-3’ unimiR
miR-106a 5’-AAAAGTGCTTACAGTGCAGGTAG-3’ unimiR