Skip to main content

Table 1 Primers and PCR conditions used for detecting splice pattern (Forward: Fwd; Reverse: Rev)

From: The Trem2 R47H Alzheimer’s risk variant impairs splicing and reduces Trem2 mRNA and protein in mice but not in humans

Name Sequence Reaction condition
MmTrem2 Fwd GCTCAATCCAGGAGCACAGT 95 °C 1 min; (95 °C 30s, 65 °C 15 s, 72 °C 1 min) *35 cycle; 72 °C 10 min
MmTrem2 Rev TCTGACACTGGTAGAGGCCC
HsTREM2 Fwd GCCTGACATGCCTGATCCTC 95 °C 1 min; (95 °C 30s, 65 °C 15 s, 72 °C 1 min) *35 cycle; 72 °C 10 min
HsTREM2 Rev AGGACCTTCCTGAGGGTGTC