Skip to main content

Table 1 Primers used for qRT-PCR

From: Glucose transporter 1 critically controls microglial activation through facilitating glycolysis

Targets Annealing temperature (°C) Sequences (5′ - 3′) F: forward R: reverse
β-actin 58 F CCTTCCTTCTTGGGTATG
R TGTAAAACGCAGCTCAGTAA
GLUT1 60 F CCCCGTCCTGCTGCTATTG
R GCACCGTGAAGATGATGAAGAC
GLUT3 60 F TGTCCAGGAACCGATCTATGC
R CCACCAGGAACAGAGAAACTAC
GLUT4 60 F CCAGTATGTTGCGGATGCTAT
R TTTTAGGAAGGTGAAGATGAAGAAG
GLUT5 60 F ACCTCAGCGCAGGCGTGAAA
R AGCAGGCTATGAGGCAGGTGGA
GLUT6 60 F CGTCCAGTTTGTGCCAAGG
R CAGCAGGGGTATCAGGGTAAG
GLUT8 60 F GCTCACCGCTGCCTTCTG
R CGAAATGGGCTGTGACTTGTT
GLUT9 60 F ACTATGTGGACTCAATGCGATCT
R TCAATGACCAAGCCAGAGAAGA
GLUT10 60 F CTCTGTGGCGTTCATCAAGTG
R ACGAGGAAGGCGGAGACT
GLUT12 60 F TGGCAGCAAAACCTTCCTCT
R AGGGACTGGTTAAGAAGACTATGG
GLUT13 60 F CTGGAATAAACTGGATTTTCAACG
R TCAGGGAGGCAGCCATAGA
Arginase 1 61 F TTATCGGAGCGCCTTTCTCAA
R TGGTCTCTCACGTCATACTCTGT
CCL2 58 F AGGTCCCTGTCATGCTTCTG
R TCTGGACCCATTCCTTCTT
IL-1β 61 F TCCTTGTGCAAGTGTCTGAAGC
R ATGAGTGATACTGCCTGCCTGA
iNOS 60 F GGCAAACCCAAGGTCTACGTT
R TCGCTCAAGTTCAGCTTGGT
TNF-α 58 F GCCTCTTCTCATTCCTGCTT
R CTCCTCCACTTGGTGGTTTG
IL-12P40 60 F GACATCATCAAACCAGACCCGCC
R GCCTTTGCATTGGACTTCGGT