Skip to main content

Table 2 Primers and their sequences for real time RT-PCR

From: Deletion of Socs3 in LysM+ cells and Cx3cr1 resulted in age-dependent development of retinal microgliopathy

Genes Forward Reverse
βactin GGCACCACACCTTCTACAATG GGGGTGTTGAAGGTCTCAAAC
TNF-α TCTCATGCACCACCATCAAGGACT ACCACTCTCCCTTTGCAGAACTCA
iNOS TCTTTGACGCTCGGAACTGTAGCA ACCTGATGTTGCCATTGTTGGTGG
IL-1β AAGGGCTGCTTCCAAACCTTTGAC ATACTGCCTGCCTGAAGCTCTTGT
IL-6 ATCCAGTTGCCTTCTTGGGACTGA TAAGCCTCCGACTTGTGAAGTGGT
IL-10 GGCAGAGAACCATGGCCCAGAA AATCGATGACAGCGCCTCAGCC
IL-12p40 ATGGCCATGTGGGAGCTGGAGAAAG GTGGAGCAGCAGATGTGAGTGGCT
IL-23p19 ATGTGCCCCGTATCCAGTGT GGGGTGATCCTCTGGCTGGA
ARG1 TTATCGAGCGCCTTTCTCAA TGGTCTCTCAGGTCATACTCTGT
CD206 TCAGCTATTGGACGCGAGGCA TCCGGGTTGCAAGTTGCCGT
CCL2 GCATCCACGTGTTGGCTCA CTCCAGCCTACTCATTGGGATCA
CCL5 ACTCCCTGCTGCTTTGCCTAC GAGGTTCCTTCGAGTGACA
CXCL2 AAGTTTGCCTTGACCCTGAA AGGCACATCAGGTACGATCC
C1Qb ATAAAGGGGGAGAAAGGGCT CGTTGCGTGGCTCATAGTT
CD16 CAGAATGCACACTCTGGAAGC GGGTCCCTTCGCACATCAG
CD32 AGGGCCTCCATCTGGACTG GTGGTTCTGGTAATCATGCTCTG
CD64 AGGTTCCTCAATGCCAAGTGA GCGACCTCCGAATCTGAAGA
CD36 ATGGGCTGTGATCGGAACTG GTCTTCCCAATAAGCATGTCTCC
CD47 CACAGTCATCGTGGTTGTTGGA GTGATCAATATGGCAATGGTGAAAG
Trem2 CTGGAACCGTCACCATCACTC CGAAACTCGATGACTCCTCGG
Anxa1 ATGTATCCTCGGATGTTGCTGC TGAGCATTGGTCCTCTTGGTA
\