Skip to main content

Table 3 Primer sequences used for selfie qRT-PCR and dPCR analysis

From: Cholesterol alters mitophagy by impairing optineurin recruitment and lysosomal clearance in Alzheimer’s disease

Amplicon Forward sequence Reverse sequence
Bax-72 CACTGCCTTGGACTGTGTCT CCTTTCCCCTTCCCCCATTC
Gsk3β-81 CGAACTCCACCAGAGGCAAT AGCTTCCAGTGGTGTTAGCC
Hmgcs1 TGCACGGATCGTGAAGACAT GCCGCCCAATGCAATCATAG
Ldlr GTGAGACAACAGCCCTCCTC CAGGTGAATTTGGGCGAGTG
mtDNA-80 AGCTCAATCTGCTTACGCCA GCAATAACAAGTGCTATGTGGCT
TBP1–73 CACCACAGCTCTTCCACTCA GGGGAGGGATACAGTGGAGT
TEFM-88 GTGACTCCCGGACTAGTGGA GATGGGAAGAACACCCGAGG
Tfam GGGAATGTGGAGCGTGCTAA GATAGACGAGGGGATGCGAC
WPRE-106 TGGACAGGGGCTCGGCTGTT CGCGCAGAATCCAGGTGGCA