Skip to main content

Table 4 List of primers used for Real Time RT-PCR.

From: Angiotensin type 1 receptor antagonist losartan, reduces MPTP-induced degeneration of dopaminergic neurons in substantia nigra

Atgr2 accaatcggtcatctaccctt left
  ggcaatgaggatagacaagcc right
GAPDH tggtgaagcaggcatctgag left
  tgctgttgaagtcgcaggag right
TH ttctgaaggaacggactgg left
  ggcatgacggatgactgtg right