Skip to main content

Table 1 Sequences of primers and probes for the APOE genotyping assay

From: A rapid and cost-effective method for genotyping apolipoprotein E gene polymorphism

Name Sequence (5’-3’)
ε2-Forward GCGGACATGGAGGACGTGT
ε2-Reverse CCTGGTACACTGCCAGGCA
ε3-Forward CGGACATGGAGGACGTGT
ε3-Reverse CTGGTACACTGCCAGGCG
ε4-Forward CGGACATGGAGGACGTGC
ε4-Reverse CTGGTACACTGCCAGGCG
APOE probe FAM-CAGCTCCTCGGTGCTCTGGC-BHQ1
ACTB-Forward GACGTGGACATCCGCAAAGAC
ACTB-Reverse CAGGTCAGCTCAGGCAGGAA
ACTB probe HEX-TGCTGTCTGGCGGCACCACCATGTACC-BHQ1