SDIM1 is a novel transmembrane protein down regulated in AD brains

We have isolated a cDNA fragment by subtractive hybridization using a pooled mRNA population from AD brains as a "driver" and the first strand cDNAs from a pooled age-matched control brains as a "tester" [10]. BLAST searches revealed that this fragment matches with human cDNA FLJ26122 fis, clone SYN00634 on chromosome 6 [GenBank AK129633, AL590482], encoding an unnamed protein product [GenBank BAC85201.1] of 146 amino acids (aa), with a calculated molecular weight of ~13 kDa. The predicted primary structure of this protein contained a typical N-terminal signal peptide of 26 aa. There are two primary transmembrane helices spanning amino acids 69 to 91, 97 to 119, respectively (Figure 1). No matching cDNAs from rodents were found in the GenBank. Based on its structure and putative function determined by present study, we named this gene as stress responsive DNAJB4 interacting membrane protein 1 (SDIM1, HGNC approved). Since the SDIM1 transcript was found in the subtracted cDNA library containing genes potentially down regulated in AD brains, we re-examined these changes by qRT-PCR analysis (Figure 2A) of the RNA pools used to construct the original AD and control cDNA libraries [10]. These results were further confirmed by qRT-PCR using 19 individual brain samples from a tissue bank (Table 1). As shown in Figure 2B the SDIM1 transcript level was significantly lower in most AD brains in comparison to the age-matched controls, suggesting that SDIM1 transcript is indeed down regulated on AD brains.

Expression pattern of SDIM1

Since the SDIM1 sequence exists in the GenBank as a hypothetical protein, we set out to produce a specific anti-SDIM1 antibody that can detect SDIM1 gene product in tissues and cell lines. A polyclonal anti-SDIM1 peptide antiserum was generated in rabbits and further purified by immumoaffinity methods. This anti-SDIM1 antibody faithfully recognized recombinant GST-SDIM1 fusion protein (Figure 3A, right lane) and detected two bands from the protein extract from NT2 neurons (Figure 3B). The lower band was located near 13-15 kDa and the upper one appears at 26-27 kDa on SDS-PAGE, which suggests that SDIM1 might form dimeric aggregates under denaturing conditions. Modifying the concentrations of DTT, β-mercaptoethanol, and urea in the loading buffer, as well as changing the boiling temperature from 100°C for 5 Min to 55°C for 30 min did not break up these aggregations. SDIM1 protein sequence contains two potential phosphorylation sites and two O-linked glycosylation sites. There is no N-linked glycosylation site on this protein. The size increase resulted from these modifications do not seem to match the size shift seen on the gel (Figure 3B). Mono-ubiquitination may be a possibility for the upper band that is recognized by anti-SDIM1 antibody. However, neither band was recognized by anti-ubiquitin antibody in western analysis experiments (Figure 3C). Throughout the present study, we noticed that the intensity of the upper band was always more pronounced than the lower band, the upper band increased as the lower band decreased and the lower band could disappear completely if the same protein extracts had been freeze-dried or been passed through multiple freeze-thaw cycles prior to gel separation. This phenomenon led us to believe that the band shift was a result of dimeric aggregation, instead of enzymatic modification, which normally occurs under physiological conditions in vivo. To prove that SDIM1 forms dimeric structure, we performed co-immunoprecipitation experiments, where cellular proteins from cells transfected with pEGFP-N1 or pSDIM1-EGFP plasmids were mixed with purified GST-SDIM1 fusion protein. Immunoprecipitation was performed using anti-GST antibody and the precipitated proteins were detected by anti-GST, anti-EGFP and anti-SDIM1 antibodies. These experiments showed that GST-SDIM1 formed dimmers (Figure 3D, left panel, lane 4, also see Figure 3A) and it also formed hetero-dimers with SDIM1-EGFP (Figure 3D, left panel, lane 4 and middle panel, lane 4). SDIM1-EGFP also formed self-dimmers as we observed a faint band in the lane with total cellular proteins extracted from pSDIM1-EGFP transfected cells (Figure 3D middle panel, lane 2). The dimeric structures on the membrane shown in figure 3D, middle panel, were further detected by anti-SDIM1 antibody (Figure 3D right panel) and we did not detect dimerization of EGFP with GST-SDIM1 (Figure 3D middle and right panels, lane 3). Western analyses revealed ubiquitous expression of SDIM1 in human and mouse tissues with higher levels in brain, muscle, heart and reproductive organs (Figure 3E and 3F). SDIM1 dimer was the dominant form in the brain, where the monomer was almost non-detectable. We also observed small amounts of dimers in freshly extracted cervix and muscle samples, where SDIM1 is more abundant (Figure 3E and 3F). Western analysis of proteins extracted from control and AD brain context showed that the overall SDIM1 protein levels in AD samples were indeed lower than those of controls (Figure 3G). We only observed trace amounts of SDIM1 monomer in control samples, but it was not detectable in the AD samples. Quantitative RT-PCR analysis detected very low levels of SDIM1 transcript in undifferentiated NT2 cells and NT2 derived astrocytes, but with significantly increased expression in NT2 neurons (Figure 4A). Its abundance in neurons was further confirmed by Western analysis using anti-SDIM1 antibody (Figure 4B). In these cells the dimer was also seen as the dominant form of SDIM1. To examine the cellular localization of SDIM1, we double stained mouse primary neuronal cultures with SDIM1 and MAP2 antibodies. SDIM1 protein is located mainly in the cytoplasm and distributed throughout the neuro-processes (Figure 4C a). Although SDIM1 has similar cellular distribution as that of MAP2 in mature neurons, it is not co-localized with MAP2 in the processes (Figure 4C d). Consistent with the Western analysis results shown in 4B, in the immature neurons, where there was no MAP2 immunoreactivity, we observed less SDIM1 staining than in mature neurons (Figure 4C arrowheads), suggesting that SDIM1 is more abundant in neuronal cells in the brain.

SDIM1 is highly responsive to stress conditions mimicking injurious insults

We analyzed the SDIM1 expression level in post-mitotic NT2 neurons subjected to oxygen and glucose deprivation (OGD), which has been previously reported to trigger neuronal apoptosis [11]. Here, initially the cells were subjected to 2 h OGD treatment, during which 10-15% of cells lost viability, followed by a 16 h recovery period, at the end of which cell death reached 35-40%. The SDIM1 mRNA was significantly down regulated after the OGD treatment (Figure 5A), but became significantly up regulated 16 h after recovery. The changes in protein level, as verified by Western blot analysis, followed the same pattern (Figure 5B). Cultured mouse primary neurons responded to OGD treatment in the same fashion as that of the NT2 neurons (Figure 5C). Immunostaining of these OGD treated primary neurons showed that they had decreased immunoreactivity to anti-SDIM1 antibody and the cells appeared to have retracted their processes (Figure 5D). However, 16 h after re-oxygenation, the surviving cells had much brighter SDIM1 staining and normal neural processes. Dead or dying cells contained much less SDIM1 protein (data not shown). Taken together, our results indicated that SDIM1 had a bi-phasic response to cell death inducing injuries - a down regulation in response to the initial treatment, followed by significant up regulation in surviving cells.

Overexpression of SDIM1 protected cells from injurious insults and its downregulation accelerated cell death caused by OGD in neuronal progenitor cells

To better understand the role of SDIM1 in neuroprotection we examined the effects of gene over-expression in the N2a cell line. We cloned the coding region of SDIM1 into a mammalian expression vector, pEGFP-N1, with a stop codon inserted between the end of the SDIM1 and the beginning of EGFP. As a result, a faint green fluorescent signal was observed in the cells transfected with the plasmid construct, but the SDIM1 protein was free to perform its routine function without the possible interference of the EGFP. A time course experiment was performed in order to determine a time point, when SDIM1 protein reached the plateau. While there was a gradual increase in protein level from 16 h to 21 h after transfection, we were surprised to discover that SDIM1 protein level deceased quickly after it reached the plateau at 21 h. Although the mRNA level remained much higher than the untransfected control, protein levels dropped to the same level 24 h after transfection (Figure 6A and 6B). This result suggests that there is a degradation mechanism controlling the protein level of SDIM1. Therefore over-expression of SDIM1 for 21 h was chosen for subsequent over-expression and OGD treatment experiments. When SDIM1 was over expressed in N2a cells without any cell death inducer, we did not observe any changes in cell viability. However, when the transfected cells were challenged by OGD treatment, we observed a significant decrease in cell death when compared with cell populations transfected with pEGFP-N1 vector control (Figure 6C). Next, we down regulated the endogenous SDIM1 in NT2 cells using a mixture of four siRNAs targeting human SDIM1. Most of the SDIM1 transcript and protein were knocked down 24 h after the siRNA transfection (Figure 6D). The transfected cells (after 24 h) were subjected to 6 h OGD treatment plus 16 h re-oxygenation and examined for cell viability (Figure 6E). When endogenous SDIM1 was knocked down by siRNA alone, no significant increase in cell death percentage was observed. However, down-regulation of the endogenous SDIM1 followed by OGD treatment significantly increased the percentage of cell death caused by OGD treatment.

SDIM1 interacts with a DnaJ-like heat shock protein

To further identify the roles of SDIM1 in neuronal cell death or survival we performed yeast two-hybrid screening to identify its potential interacting proteins in human brain. Yeast strain AH109 harboring the two-hybrid construct (pGBKT7-SDIM1) expressing full length human SDIM1 was used to screen a human brain expression cDNA library. Among 4 clones that displayed Ade/His prototype and β-galactosidase activity, one sequence was found to encode human DnaJ-like heat shock protein (DNAJB4), also known as HLJ1. The interaction between these two proteins was reproducibly reconstructed in the yeast two-hybrid system and it passed all required tests (Figure 7A). Because the endogenous levels of SDIM1 and DNAJB4 were very low in most cell lines, in order to establish the interaction of these two proteins in vivo, we co-transfected flag-tagged DNAJB4 and EGFP tagged SDIM1 plasmids into HEK 293 cells. The transfected cells were harvested and the protein extracts were immmunoprecipitated with anti-flag antibody. The precipitated protein complex was boiled and separated by SDS/PAGE. The blot was first probed with anti-flag antibody to ensure that DNAJB4 protein was successfully precipitated by the anti-flag antibody (Figure 7B). The same protein samples were subsequently probed with anti-SDIM1 or anti-EGFP antibody for SDIM1 (Figure 7C). Our results confirmed the interaction detected through the yeast two-hybrid assay. Next, we examined the sub-cellular localization of these proteins by double staining of mouse primary neurons with anti SDIM1 and DNAJB4 antibodies. Co-localization of these proteins was detected in the cytoplasm and neuroprocesses (Figure 7D). Decreased amounts of SDIM1 were detected in apoptotic cells; only trace amounts of DNAJB4 was detected in these dying cells (Figure 7D, b and 7c, arrowhead). This result is in agreement with the physical interaction detected in the yeast two-hybrid and co-immunoprecipitation assays.

SDIM1 attenuates cell death induced by DNAJB4 overexpression

To understand the biological significance of the interaction between SDIM1 and DNAJB4, we first examined the expression patterns of DNAJB4 in AD brains and in cultured NT2 and primary neurons. We did not detected significant changes of DNAJB4 transcript in AD brains by qRT-PCR (data not show). We detected a bi-phasic change of DNAJB4 protein in NT2 and mouse primary neurons after OGD treatment and re-oxygenation similar to that observed with SDIM1 (Figure. 8A and 8B). However, we did not observe an increased expression of DNAJB4 in surviving cells in these neuronal cultures 16 h after re-oxygenation. The DNAJB4 level in the recovering cells (after re-oxygenation) was always lower than that of untreated cells. These data suggested that DNAJB4 may not have a protective function similar to SDIM1 in surviving cells. To test this hypothesis, we transiently over-expressed DNAJB4 in N2a cells with a pCMV-DNAJB4-Tag1 plasmid for 21 h. Surprisingly, over-expression of DNAJB4 triggered significant amounts of cell death as compared with mock transfection of empty vector, and co-transfection of DNAJB4 with SDIM1 attenuated cell death caused by DNAJNB4 over-expression (Figure 8C). The subsequent challenge of these transfected cells with OGD caused additional loss of cells in all samples, but the prior observations were reproduced in that SDIM1 over-expression reduced cell death caused by both OGD treatment and DNAJB4 over-expression (Figure 8D). The over-expression of DNAJB4 and SDIM1 proteins in the transfected cells were confirmed by Western analyses (Figure 8E). To investigate whether DNAJB4 induced cell death is through SDIM1 degradation mediated by DNAJB4; we performed a time course experiment of DNAJB4 over-expression and assessed the levels of endogenous SDIM1. While we detected a consistent increase of DNAJB4 levels at 16, 18, 21 and 24 hour time points due to the transfection of pCMV-DNAJB4-tag1 plasmid, we did not observe a decrease of SDIM1 protein at any time point (data not show); instead, we found a significant increased of SDIM mRNA and protein levels 24 h after DNAJB4 over-expression (Figure 8F and 8G). Next, we down regulated the endogenous DNAJB4 alone or SDIM1 and DNAJB4 simultaneously using synthetic siRNAs targeting human DNAJB4 and/or SDIM1 in human NT2 cells. The proteins were knocked down 24 h after siRNA transfection (Figure 8H). The transfected cells were then subjected to 6 h OGD treatment and 16 h re-oxygenation in a normal culture chamber and examined for cell viability (Figure 8I). The results showed that down regulation of DNAJB4 significantly reduced the percentage of cell death caused by OGD treatment. In contrast, down regulation of SDIM1 significantly increased cell death percentage and when both proteins were knocked down the cell death percentage returned to levels similar to control cells (Figurs. 6E, 8I), suggesting that endogenous DNAJB4 can promote cell death triggered by OGD and endogenous SDIM1 promotes cell survival.

Cell culture and oxygen-glucose deprivation (OGD) treatment

Human embryonal teratocarcinoma Atera2/D1 (NT2) cells (Stratagene, La Jolla, CA), mouse Neuro-2a (N2a) neuroblastoma cells (ATCC CCL-131) and human HEK 293 cells [18] were cultured in Dulbecco's modified Eagle's medium (Invitrogen, Bethesda, MD) supplemented with 10% fetal calf serum (GCS, Wisent, Inc. St. Bruno, PQ). NT2 cells were differentiated into neurons and astrocytes with all trans-retinoic acid (RA, Sigma, Oakville, ON) according to the method of Pleasure and Lee [19] as described previously [20]. Mouse primary cortical neurons were prepared from embryonic E15-16 CD1 mice and cultured in neurobasal media for 5-14 days as previously described [21].

For OGD treatment, NT2 neurons and mouse primary neurons were washed once with glucose-free DMEM, and incubated in glucose-free DMEM with 10% FBS for 2 h in a hypoxic chamber (Forma 1025 Anaerobic Chamber; ThermoForma, Marietta, OH, USA). At the end of the OGD treatment, cells were removed from the chamber and returned to the incubator for 16 h. The same OGD treatment was performed with undifferentiated NT2 and N2a cells except the incubation in OGD conditions was increased to 6 h due to their resistance to OGD treatment. Cell viability for all cell lines was assessed by the Trypan Blue (Sigma, Oakville, ON) exclusion assay. In this procedure, all floating cells were collected from culture media and washing buffer, and then combined with the trypsinized cells. Cells were incubated in the Trypan Blue dye for 5 min. Labelled cells were counted using a hemocytometer.

RNA extraction, real time quantitative RT-PCR (qRT-PCR) and semi-quantitative RT-RCR

RNA extraction, first strand cDNA synthesis, and qRT-PCR analysis were performed as described previously [22]. RNA pools extracted from frontal cortex of postmortem human brain samples described previously [23] were used for subtractive hybridization and qRT-PCR. Additional brain samples were obtained from the Human Brain and Spinal Fluid Resource Center ([24], VAMC, Los Angeles, CA), which is sponsored by NINDS/NIMN, National Multiple Sclerosis Society, VA Greater Los Angeles Healthcare System, and Veterans Health Services and Research Administration, Department of Veteran Affairs. To detect the expression level of the SDIM1 transcript in brain tissue and cultured cells, equal amounts of cDNA (2 ng each) were used with the primers: SDIM1F 5' GGGCCATGAACACATCACTTG 3' and SDIM1R 5' TCAGGTCAAAGTTGGCAATGAA 3'. The DNAJB4 transcript was detect by using the primers: DNAJB4F 5' TCTCAAACAAGACCCTCCCA 3' and DNAJB4R 5' ATGGCAGCCCATATCCAATA 3'. PCR was performed using a ABI 7500 FAST Real Time PCR system and reagents according to the manufacturer's instructions. The primers used for semi-quantitative RT-PCR for SDIM1 are: F 5' TCGGTGGGAAGACTGCTTAT 3' and R 5' CGTCTGTCCTGTGACATGGT 3'; for DNAJB4 are: F 5' TGGTTGTACCAAACGGATGA 3' and R 5' ATGGCAGCCCATATCCAATA 3'.

Plasmids, transient transfections and staining

Human cDNA encoding the mature (without the signal peptide) SDIM1 protein was cloned into the pGEX -3X vector (GE Healthcare, Baie d'Urfe Quebec) for GST-SDIM1 fusion protein production. The first amino acid after the signal peptide (position 27) was mutated from "C" to "A" in order to increase the solubility of the recombinant SDIM1 protein in E. coli. Human cDNA encoding full length SDIM1 protein was cloned in the pEGFP-N1 vector (Clontech, Palo Alto, CA, USA) with or without a stop codon added between the C-terminus of SDIM1 and the EGFP sequence (Invitrogen, Burlington, ON) to produce pSDIM1*EGFP, pSDIM1-EGFP respectively. The coding region of the human DNAJB4 cDNA was cloned into the pCMV-Tag1 vector to create a pCMV-DNAJB4-Tag1 construct.

For overexpression analysis, N2a cells were plated in 6-well plates at a density of 0.5 × 10⁶ cells/well, 24 h before transfection. Cells were transfected with 5 μg pCMV-DNAJB4-Tag1 plasmid or pSDIM1*EGFP plasmid and 15 μl lipofectAmine 2000 reagent, or co-transfected with 2.5 μg each of the pSDIM1*EGFP and pCMV-DNAJB4-Tag1 plasmids plus 15 μl lipofectAmine 2000 reagent. Cells were collected for Trypan Blue exclusion assay as well as total RNA and protein extraction 16-24 h after transfection; or treated with OGD for 6 h plus 16 h recovery prior to Trypan blue assay or total RNA and protein extraction. For siRNA silencing, the siRNAs were purchased from GenePgarma (Shanghai GenePgarma Co, Ltd, Shanghai, PRC). Undifferentiated NT2 cells were plated in 12-well plates at a density of 0.25 × 10⁶ cells/well, 24 h before transfection. Cell were transfected with 100 μM mixed human SDIM1 siRNAs containing a pool of two sequences: 5' UUAAACAGAGAUAUAAGUC 3' and 5' UUUAAUAGACCACAAACUC 3' and/or 100 μM mixed human DNAJB4 siRNAs containing three sequences: 5' UUGGAUAGUCUAGCACUUC 3', 5' UUUCUUCAGAAUCUCUACC 3' and 5' UUUCGAGAAAUCUUCAUCC 3' using Dharmafect1 transfection reagent according the manufacturer's instructions (Dharmacon, Thermo Fisher Scientific, Inc). Cells were subjected to 6 h OGD treatment 24 h after transfection and collected for Trypan Blue exclusion assay 16 h after re-oxygenation. For co-immunoprecipitation analysis, HEK 293 cells were plated in 10 cm plates at a density of 2 × 10⁶ cells /plate, 24 h before transfection. Cells were transfected with 15 μg of pEGFPN1 or pSDIM1-EGFP alone, or co-transfected with 7.5 μg each of pSDIM1-EGFP and pCMV-DNAJB4-Tag1 plasmids DNA mixed with 45 μl LipofectAmine 2000 reagent. Cells were collected for total protein extraction 21 h after transfection. For cellular localization of SDIM1, mouse primary cortical neurons were stained (or double-stained) with anti-SDIM1 (dilution1:100 v/v), anti-MAP2 (1:200 v/v dilution, Novus Biologicals, Inc Littleton, CO), or anti-DNAJB4 (1:100 v/v dilution, abcam, Cambridge, MA) antibodies, followed by FITC -conjugated anti-rabbit IgG, rhodomine-conjugated anti-mouse IgG (for MAP2 and DNAJB4). The nuclei were counterstained with DAPI in PBS for 5 min and then mounted in Vectashield mounting medium (Vector laboratories, Burlingame CA, USA). The cells were viewed with a Zeiss Axiovert 200 M fluorescence microscope equipped with a Zeiss AxioCam camera (Zeiss, Midland, ON). The images were captured and analyzed using Zeiss Axiovision 3.1 software.

Antibody production and purification

Custom polyclonal antibody (GenScprit, Piscataway, NJ) was produced using synthetic peptide N'-LGSPLSLWSIKTPS. The immune serum was purified by immunoaffinity purification using recombinant GST-SDIM1 fusion protein. Briefly, purified GST-SDIM1 fusion protein was separated by SDS-PAGE and electro-blotted onto a nitrocellulose membrane. The Ponceau stained membrane portion containing the SDIM1 antigen was excised and subjected to a Western blotting procedure using 2 mL original crude serum. The bound antigen-specific antibody was eluted with 0.1 M Glycine-HCl buffer, pH 2.7. The eluted antibody was neutralized by adding 1/10 volume of 1 M Tris, pH 8.5, concentrated using Amicon Ultra-15 Centrifugal Filter Device (Millipore, Fisher Scientific, Ottawa, ON).

Protein extraction, Western blotting and co-immunoprecipitation

Recombinant GST-SDIM1 fusion protein was purified from Rosetta cells using a glutathione column according to the manufacturer's instruction (GE Healthcare, Baie d'Urfe Quebec). Mouse tissues were frozen in liquid nitrogen and homogenized in RIPA buffer in an electronic homogenizer and then kept on ice for 45 min. The samples were centrifuged at 14,000 xg for 10 min at 4°C to collect the supernatant for total cellular proteins. For total protein extraction from cultured cells, cells were trypsinized and collected by centrifugation. They were washed twice with PBS and lysed with RIPA buffer containing 1X protease Inhibitor cocktail (Roche Diagnostics, Indianapolis, IN). The lysate was vortexed and incubated on ice for 15 min, followed by sonication for 30 sec. In some cases the total cellular protein was freeze-dried and reconstituted in PBS in order to achieve a higher concentration. Western blotting analyses were performed as previously described [25]. Human tissue protein blot was purchased from BioChain Institute, Inc (Hayward, CA, USA). Each lane contains 50 μg of total cellular protein. The blots were probed with the following primary antibodies: Rabbit polyclonal, affinity-purified anti-SDIM1 (1:5000), rabbit polyclonal anti-flag (1:1000, Rockland, Gilbertsville, PA), mouse monoclonal anti-DNAJB4 (1:1000, Abcam, Cambridge, MA), mouse monoclonal anti-EGFP (1:1000, Milipore, Temecula, CA), goat polyclonal anti-GST (1:1000, Amersham Phamacia Biotech, Baie d'Urfe, QC), mouse monoclonal anti-ubiquitin (1:1000) and mouse monoclonal anti-β-actin (1:5000, both Sigma, Oakville, ON), and mouse monoclonal anti-GAPDH (1:10,000 v/v, Milipore, Temecula, CA). The antigens were detected using horseradish peroxidase-conjugated secondary antibodies: anti-mouse IgG (1:5000 v/v), anti-rabbit IgG (1:5000 v/v, both from Jackson ImmunoResearch Laboratories, Inc., West Grove, PA) or anti-goat IgG (1:5000, Sigma, Oakville, ON). The antigen-antibody complexes were visualized by enhanced chemiluminescence using an ECL Plus detection kit (Amersham Phamacia Biotech, Baie d'Urfe, QC).

For the co-immmunoprecipitation assay, flag-tagged DNAJB4 and EGFP-tagged SDIM1 constructs were transiently co-transfected into HEK-293 cells and total cellular proteins were extracted as described above. In another case, purified GST-SDIM1 protein was mixed with cellular proteins extracted from HEK-293 cells transfected with pEGFP-N1 or pSDIM1-EGFP. The immunoprecipitation procedure was as described previously [26] and precipitated complexes were boiled in protein loading buffer and separated by SDS-PAGE. The presence of SDIM1, DNAJB4, GST-SDIM1, and SDIM1-EGFP in the complex was revealed by Western blotting as described above.

Yeast two-hybrid screening

Human cDNA encoding the full length SDIM1 protein was cloned into the pGBKT7 vector (Clontch, Palo Alto, CA, USA) to generate a chimaeric open reading frame encoding the Gal4 DNA binding domain and SDIM1 protein. This construct was introduced into Saccharomyces cerevisiae strain AH109. A single colony containing cells harboring the pGBKT7-SDIM1 plasmid was then used to provide host cells for screening a human brain cDNA expression library constructed using the pACT2 vector (Clontech, Palo Alto, CA, USA). The protein-protein interaction was first screened by plating the transformants onto SD/-Trp-Leu-His-Ade selection plates. Positive clones were then re-screened for the presence of β-galactosidase activity to eliminate false interactions. Library plasmids harboring SDIM1 interacting proteins were rescued and re-introduced into the pGBKT7/SDIM1-containing host cells to further eliminate false interactions. The identity of the cDNA encoding SDIM1-interacting protein was revealed by DNA sequencing and database searches.